La secuenciación de genes e identificación molecular en pimientos morrones

Los canales iónicos desempeñan un papel fundamental en el mantenimiento de la homeostasis celular, uno de los procesos más importantes en la producción vegetal. Los canales de potasio son sumamente interesantes porque transportan los nutrientes que utilizan las células en los procesos fisiológicos. El propósito de este trabajo fue detectar los códigos genéticos para el canal iónico del potasio AKT1 en las raíces de plántulas de pimiento bell. El PCR se estandarizó para la detección de AKT1 y se sintetizó el oligo: AAGATCAGATGCACCTTGACTT (se obtuvo la mejor alineación a una temperatura de 62 °C), para después ser secuenciado y analizado, dando como resultado una identidad del 94-97% en NCBI, con el gen AKT1.

La asimilación específica del potasio (K+) en las células vegetales se debe a las proteínas que atraviesan la membrana celular, llamadas “canales iónicos,” las cuales son responsables de la homeostasis celular [Anschütz et al., 2014; Zörb et al., 2014]. AKT1, KAT1 y KAT2, facilitan la entrada de K+ dentro de la célula y son sensibles a la concentración externa de K+ [Meinke et al., 1998, Garriga et al., 2017]. El ion de potasio (K+) es el elemento nutricional más abundante en las células del parénquima vegetal [Xu et al., 2002]. Este nutriente representa más del 10% del total de la materia seca de las plantas y ayuda a la exploración de las raíces. Los mecanismos cinéticos involucrados en la absorción del potasio fueron descritos hace más de 50 años [Martinez-Cordero et al., 2005].

K+ es absorbido a través de los canales iónicos de las membranas principalmente en las raíces, las cuales son activadas por la acción eléctrica generada como respuesta a la presencia de potasio externo proveniente de las células, variando de 10 µM a 10 mM [Maathuis y Sanders, 1994]. Es más común que las raíces absorban los iones tomándolos de fuentes inorgánicas, en especial los de los elementos monovalentes.

K+ es un cofactor importante en el metabolismo de las enzimas, los carbohidratos y las proteínas. [Mengutay et al., 2013], K+ participa en funciones orgánicas, tales como la regulación del pH y la regulación osmótica de las plantas. Existen otros elementos que participan de la función osmótica, sin embargo el potasio es el elemento más importante para mantener el equilibrio hídrico en las células. La síntesis proteica en el floema en forma de malato, el cual es descarboxilado y transformado en piruvato y HCO3 (lo cual genera un aumento en el pH de la rizosfera y es intercambiado por NO3, el principal componente de las proteínas) tiene un rol fundamental en la fotosíntesis, debido a su participación en la producción de trifosfato de adenosina (ATP), el cual es importante para la conversión de CO2 en glucosa.

El potasio también participa en la fijación de N2 atmosférico en las leguminosas, debido a su capacidad de reciclar el contenido del suelo [Giacomini et al., 2003], y también es responsable de transportar y almacenar los nutrimentos (asimilados) y regular la apertura y cierre de los estomas. Al aumentar el contenido de potasio en las células de guardia se favorece la absorción de agua en las células adyacentes, aumentando la turgencia y permitiendo la apertura de los estomas [Kant et al, 2005].

Un nivel suficiente de K+ también reduce el ataque de hongos, bacterias, virus y nematodos en las plantas, principalmente a través de la síntesis de jasmonatos y glucosinolatos [Zörb et al., 2014]. Además de ello, cuando hay carencia de potasio, la acumulación de los azúcares en las hojas las vuelve más apetitosas para algunos insectos y bacterias que pueden entrar por los estomas [Melotto et al., 2006].

La ausencia de K+ incrementa los azúcares en las hojas y éstos pueden llegar a reemplazar a las moléculas osmóticas [Zörb et al., 2014]. La absorción de K+ es regulada por cotransportadores a bajas concentraciones y por canales iónicos a altas concentraciones. El propósito de esta investigación fue estandarizar el método de detección del gen del canal iónico de potasio AKT1 mediante PCR, para identificar el gen que codifica la proteína AKT1 en el pimiento Bell.

Métodos y Materiales

El estudio fue realizado en el instituto Nacional de Investigación Forestal, Agrícola y Pecuaria (Inifap), ubicado en el municipio de Culiacán, Sinaloa, a 24º63 de latitud norte y 107º44’ longitud oeste, con 22 MASL. Las temperaturas en exteriores promediaron 20 ºC, con temperaturas máximas de 28 ºC y temperaturas mínimas de 16 ºC, durante el periodo de noviembre 25, 2014 a enero 17, 2015. Las semillas que se utilizaron fueron de A. thaliana variedad “Columbia” obtenidas del Colégio de Postgraduados Campus “Montecillo”, Ciudad de México y pimiento Bell (C. annuum L.) variedad “Cannon”. Las plantas fueron sembradas en charolas de poliestireno para plántulas de 200 celdas con volúmenes individuales de 30 cm3 cada una, con peat moss como substrato. Las charolas fueron germinadas en un invernadero de policarbonato ventilado con un área de 4 x 5 m, cubierto con una malla sombra de color negro (50%). Las charolas de poliestireno fueron desinfectadas con hipoclorito de sodio al 1% durante 15 minutos y el sustrato utilizado fue esterilizado en autoclave por 2 horas.

El manejo de la solución nutritiva (SN) de las plántulas fue balanceado de acuerdo con la “solución Steiner”, utilizando fertilizantes inorgánicos de grado reactivo y agua destilada. Diez días después de la siembra (primeras hojas verdaderas) se inició la fertilización, y la concentración aumentó cada 10 días al 50%, 75% y 100%. Las plántulas fueron regadas diariamente a las 08:00 y a las 14:00 h, asperjando el follaje con Solución Nutritiva (1 L de capacidad) hasta que la solución escurría a través de los orificios en las bases de las macetas.

Cuarenta y cinco días después de la siembra, se evaluaron los tratamientos con cincuenta plántulas y tres repeticiones para cada tratamiento, realizando un análisis de biología molecular en cada uno de ellos. Antes de eso, se extrajeron las plántulas de la charola de poliestireno, se separaron las hojuelas y las raíces y se colocaron en un tanque de Nitrógeno Taylor Wharton CryoScience con nitrógeno líquido a -20 ºC, a fin de proteger la integridad genética durante su transporte hacia el laboratorio. El extracto genómico de ADN fue aislado en las hojas y las raíces del pimiento y de la Arabidopsis (Sanger et al., 1977). Una vez obtenido el ADN, se realizó la reacción de amplificación por PCR del gen AKT1.

El Primer fue obtenido con el programa Multialin. El Primer3 fue: la herramienta del primer y la Plataforma del Genoma del Pimiento, usando la genómica de la Arabidopsis thaliana (Li et al. 2006). Se utilizó un termociclador para PCR (Nyx Technik Amplitronyx Serie 6 A6 (ATC401) Termociclador). Después de la amplificación de los productos por PCR, estos fueron separados por electroforesis en geles de agarosa al 1% (Brody and Scott, 2004).El producto de PCR purificado fue enviado al Laboratorio Nacional de Genómica para la Biodiversidad (LANGEBIO), La búsqueda de similitudes se realizó mediante el programa BLAST, el cual comparó las secuencias de nucleótidos bajo estudio, con la información de las bases de datos del Centro Nacional de Información Biotecnológica (NCBI) (http: //www.Ncbi.nlm.nih.gov/BLAST/).

Resultados y discusión

El material genético de hojas y raíces analizado por PCR muestra el resultado de la calidad del ADN y la integridad de Arabidopsis thaliana [Meinke et al., 1998] y de Capsicum annuum. La limpieza del ADN fue diferente en las raíces y en las hojas. Debido al proceso de limpieza [Sanger et al., 1977], el material genético de las hojas presentaba varias macromoléculas en color verde, y como resultado de ello, solo se eligió material genético de la raíz, la cual es el órgano de la plántula que responde a la absorción del potasio como nutriente [Maathuis y Sanders, 1994]. Los resultados sobre la calidad e integridad del material de ADN mostraron más alta definición en las raíces [Brody y Scott, 2004]. El fragmento de AKT1 fue detectado en las raíces de Arabidopsis thaliana como resultado positivo de la amplificación del gen AKT1 y se observaron los mismos resultados en las raíces del pimiento Bell.

Li et al. (2006) reportó una secuencia para la identificación del gen AKT en A. thaliana y generó un oligo que fue sintetizado y probado a distintos gradientes de temperatura y concentración, dando como resultado 26 amplicones positivos de buena calidad de un total de 272 PCRs. De los 26 positivos, 17 correspondían al oligo con la secuencia directa: (AAG ATC AGA TGC TTG CAC ACTT) e inversa: (GCT TGA ACG GAT AGC TTT AGGA) (65% de hibridación). La incidencia positiva más alta se observó en el 35% de los amplicones positivos al 62°C. Al demostrar el mismo número de incidencias a las concentraciones de 100 ng-1, 50 ng-1 y 33 ng-1, a 63 ºC se observó que la respuesta de la amplificación varía en función de la concentración. El resultado de la amplificación fue revisado en la cámara de electroforesis y se amplificó en 192 reacciones de PCR, las cuales fueron purificadas de manera subsecuente con el equipo de extracción. Se recopilaron 50 µL del producto del PCR a una concentración de 100 ng /µL.

Obtuvimos la secuencia directa: (TTT CTT TTC TAC TCT TTA GTA GAT AAG GGT TTA CTT GTT TCG GGA GTA TCA AAC GAT CTA CAG TCG AGT CTC TTC CTA AAG CCA TCC GTT CAA GCG TTT CAC ATT TTC TTT TCT ACT CTT TAG TAG), la cual contribuye a la comprensión de la diversidad molecular de las plantas [Anschütz et al., 2014]. La secuencia obtenida de las plántulas de pimiento mostraron una similitud del 97% con el reporte (GenBank NM_001288418.1), y baja afinidad en cuanto a la absorción de K+; mientras Martinez- Cordero et al. (2005) reportaron a AKT1 en alta afinidad en cuanto a la absorción de K+, la cual es esencial bajo las condiciones de poco potasio en Arabidopsis thaliana.

La identidad de las secuencias de los fragmentos amplificados fue analizada con el Programa Computarizado de Alineamiento de Secuencia del Tipo Local (Local Type Sequence Alignment Computer Program) (BLAST), del Centro Nacional de Información Biotecnológica (NCBI), mostrando un porcentaje de identidad del 99% con AKT1.

CONCLUSIONES

El procedimiento para la identificación de la codificación genética de la proteína AKT1 presente en las raíces de las plántulas de pimiento, se estandarizó con el oligo AAG ATC AGA TGC TTG CAC ACTT a una temperatura de 62°C.

La secuencia obtenida fue de 42 nucleótidos que fueron comparados en la base de datos, donde se igualaron con 9 reportes previos de AKT1.

 


Fuente: “Akt1 Molecular Identification in Bell Pepper,” por Pedro Alberto Rojas-Rojas, Sixto Velarde-Felix, Luis Alberto Lightbourn Rojas, y Saúl Parra-Terraza, Facultad de Agronomía, Universidad Autónoma de Sinaloa. Publicado en Global Advanced Research Journal of Agricultural Science, marzo 2017.

Temas: , , , , , ,

Deja un comentario

chiles/pimientos
chiles/pimientos

FreshMex celebra 10 años de excelencia en horticultura protegida

La empresa reconocida por su excelencia en el ámbito de horticultura protegida y la producción de pimientos en tecnología holandesa,

chiles/pimientos

Cómo controlar trips con un programa basado en biológicos

Los encargados de una operación de invernadero comparten a continuación su experiencia implementado un programa de manejo integrado contra trips

chiles/pimientos

Inicia un control biológico eficaz de ácaros e insectos

El control biológico de insectos, ácaros y enfermedades tiene potencial para expandir en gran medida el número de opciones efectivas

chiles/pimientos

El manejo integrado para controlar el picudo del chile

Anthonomus eugenii Cano, conocido como el picudo de chile, ataca a todos los tipos de chile. Esta plaga es capaz

chiles/pimientos

La integración más amplia de los biocontroles y bioplaguicidas

Los productos de control biológico como los plaguicidas biológicos, también llamados bioplaguicidas están siendo aprovechados en un mayor número de

chiles/pimientos

6 puntos de enfoque que van a influir la economía agrícola mexicana

Falta de suministro de productos orgánicos Los consumidores están tan interesados en alimentos y productos orgánicos que el suministro no

Artículos recientes
poscosecha y mercados

Se identifican cultivos propicios para inversión extendida

La nueva iniciativa de planeación agrícola encabezada por la Sagarpa ha identificado y evaluado una serie de cultivos estratégicos que

poscosecha y mercados

Consejos para el cumplimiento riguroso de normas de inocuidad alimentaria

En agosto 2017, los Centros para el Control y Prevención de las Enfermedades de Estados Unidos (CDC) anunciaron que un

poscosecha y mercados

Posibles escenarios del sector agropecuario ante la cancelación del TLCAN

La promulgación del Tratado de Libre Comercio con América del Norte (TLCAN) en 1994 transformó la relación bilateral México-Estados Unidos

cultivos

Conferencia de Zarzamora y Frambuesa de América del Norte

La Conferencia de la Zarzamora y Frambuesa de América del Norte (NARBA) tomará lugar en Ventura, California el próximo febrero 21-24.

nutrición vegetal

Los fertilizantes fosfatados y los radioisótopos

De acuerdo a datos estadísticos en el 2012, la producción mexicana de fertilizantes ascendió a 2.57 millones de toneladas, el

cebollas/ajo

La unión entre productores puede absorber el margen destinado a intermediarios

Tras la segunda sesión de revisión del Tratado de Libre Comercio (TLCAN – NAFTA), la incertidumbre invade al campo mexicano.

eventos

Fruit Attaction 2017, más internacional que nunca, se confirma como principal evento mundial del sector

La Feria, organizada por IFEMA y FEPEX se celebró del 18 al 20 de octubre El evento comercial, supera todas

eventos

La posibilidad de la hiperproducción alimentaria y factores térmicos y energéticos

La hiperproducción de alimentos ha pasado de ser un concepto básico de producción masiva de alimentos de alta calidad a

protección de cultivos

Guía para el control de nemátodos agalladores

Los Nemátodos Agalladores Redacción por Eduardo Crescencio Arredondo. Departamento de Fitotecnia, Universidad Autónoma Chapingo. Carretera Nacional México – Texcoco Km

cultivos

Cómo los patógenos sobreviven y dañan la cosecha de papa

Algunas de las plantas y algunos de los animales con los que estamos familiarizados tienen una cosa en común: requieren